Cloning of cDNAs Encoding Two Related 100-kD Coated Vesicle Proteins (c -Adaptins)

Coat proteins of *100-kD (adaptins) are components of the adaptor complexes which link clathrin to receptors in coated vesicles. The c~-adaptins, which are found exclusively in endocytic coated vesicles, separate into two bands on SDS gels, designated A and C (Robinson, M. S., 1987. J. Cell Biol. 104:887-895). Two distinct cDNAs (sequences 1 and 2) encoding the two oL-adaptins were cloned from a mouse brain cDNA library. Southern blotting indicates that there is one copy of each of the two a-adaptin genes, and that there are no additional closely related genes. Based on the size of the predicted protein products of the two genes (108 and 104 kD), the relative abundance of the two messages in brain and liver, and the reactivity of a sequence 1 fusion protein with different antibodies, it was possible to conclude that sequence 1 codes for A and sequence 2 for C. The two protein sequences are strikingly homologous to each other (84% identical amino acids), the major difference being an additional stretch of 41 amino acids, rich in prolines and acidic residues, inserted into the COOH-terminal half of A. In situ hybridization carried out on mouse brain sections indicates that the same cell type may express both transcripts, but that their relative expressions vary. Antipeptide antibodies are now being raised to find out whether the proteins are localized in functionally distinct populations of endocytic coated vesicles. M OST eukaryotic cells contain at least two types of clathrin-coated pits and vesicles. Coated vesicles that bud from the plasma membrane are involved in receptor-mediated endocytosis: they concentrate certain receptors and their bound ligands, allowing these proteins to be efficiently internalized. Endocytic coated vesicles also participate in the recycling of secretory granule membrane, and thus are particularly abundant in neuronal cells (Heuser and Reese, 1973). A second type of coated vesicle is associated with the Golgi apparatus and is thought to play a part in the targeting of newly synthesized proteins to lysosomes and secretory granules (Griffiths and Simons, 1986). In addition to clathrin, receptors, and ligands, coated vesicles contain clathrin-associated proteins, which have at various times been called assembly proteins (Zaremba and Keen, 1983), 100K/50K complexes (Pearse and Robinson, 1984), and, most recently, adaptors (Pearse, 1988). The adaptors are believed to mediate the interaction between clathrin and the cytoplasmic tails of receptors (reviewed by Pearse and Crowther, 1987), and therefore to determine which membrane proteins are to be recruited into a coated vesicle for transfer to another membrane compartment of the cell and which are to remain behind. Two types of adaptors have so far been identified, called HA-I and HA-II because of their relative elution from hydroxylapatite columns (Pearse and Robinson, 1984). Both have been shown to consist of a heterodimer of proteins of •100 kD, recently named adaptins (Pearse, 1988), and two associated smaller proteins, all apparently at a 1:1:1:1 molar ratio (Keen, 1987; Ahle et al., 1988). Each adaptor contains one copy of a fl-adaptin (fl or fl) and one copy of a specific adaptin: an o~-adaptin in HA-II and a 3'-adaptin in HA-I (Ahle et al., 1988). The ot-adaptins are the best characterized so far. Two major t~-adaptin bands can be seen on SDS gels of bovine brain HA-H adaptors, and these have been designated bands A and C (band B, which runs in between the two t~-adaptin bands, is the fl-adaptin). A and C have been shown to be closely related to each other on the basis of peptide mapping, NH2-terminal sequencing, and monoclonal antibody cross-reactivity. However, while C appears to be expressed in all tissues, A has only been detected in brain (Robinson and Pearse, 1986; Robinson, 1987). Antibodies against the adaptins in the HA-II adaptor provided the first clue that different adaptors might be found in different types of coated vesicles. Cells that were stained with polyclonal antisera which reacted with both orand /3-adaptins showed labeling of both plasma membrane and Golgi-associated coated vesicles, although different antisera gave somewhat different patterns (Robinson and Pearse, 1986). However, cells that were stained with monoclonal antibodies against the two ct-adaptins (A and C), which did not cross-react with/~, showed labeling exclusively of plasma membrane-associated coated vesicles (Robinson, 1987). Subsequently, Ahle et al. (1988) stained cells with monoclonal antibodies they had raised against fl and 3'They showed that fl is found in both Golgi and plasma membrane-associ© The Rockefeller University Press, 0021-9525/89/03/833/10 $2.00 The Journal of Cell Biology, Volume 108, March 1989 833-842 833 on O cber 9, 2017 jcb.rress.org D ow nladed fom ated coated vesicles, while 3' occurs only in the Golgi subset of coated vesicles. These results indicate that adaptor HA-II, containing a heterodimer of/3 and either aA or O~c, docks onto the plasma membrane, while HA-I, containing a heterodimer of/3' and % is targeted to the Golgi apparatus. Such a mechanism could allow the cell to sort different sets of receptors into coated vesicles budding from different membrane compartments. Many questions still remain to be answered. For instance, what are the precise functions of the different proteins making up the adaptor complexes? Are there additional types of coated vesicles in the cell, and if so, do they contain different adaptors? Why is there a special type of HA-II in brain, conraining A instead of C? Are A and C distinct gene products, or are they alternatively spliced products of the same gene? Are they localized in different cells, or in different parts of the same cell? As a first step toward addressing some of these questions, I have cloned and sequenced mouse brain cDNAs coding for adaptins aA and ac, the two related proteins found in the HA-II adaptor, cDNA clones encoding a/3-adaptin have also been isolated; these are now being sequenced and characterized by P. Parham and co-workers and will be described in a subsequent paper. Materials and Methods Isolation and Characterization of Clones Adaptins tXA and txc were purified from bovine brain coated vesicles by "Iris extraction followed by a combination of gel filtration, hydroxylapatite chromatography, preparative gel electrophoresis, and SDS/hydroxylapatite chromatography, as described (Robinson and Pearse, 1986). The pooled Aand C-containing fractions from the last column ('x,500/~g protein) were dialyzed against 20% ethanol containing 0.5 mM 2-mercaptoethanol, lyophilized, and dissolved in 500 #l 70% formic acid. Proteolysis was carried out with 'x,5 mg CNBr for 4 h at room temperature, after which the sample was lyophilized, dissolved in 100 #l 0.1% trifluoroacetic acid, and applied to a C18 Nucleosil microbore HPLC column. The peptides were eluted with a gradient of 0-50% CH3CN in 0.1% trifluoracetic acid, and the peak fractions were collected manually. Sequencing was performed with a gas phase sequencer (model 89013; Applied Biosystems, Inc., Foster City, CA) with on-line HPLC identification of the phenyithiohydantoin-derivitized amino acids. Two separate mixed oligonucleotides were made for peptide 34 (see Table I): 5' AGCTGCTTCCAGCGCTGGAAGAAGTCCTGGCTTGCCAT 3' A T T A G 5' AGCTGCTTCCAGCGCTGGAAGAAGTCCTGGGATGCCAT 3'. A T T T G Recombinant DNA techniques were generally those described by Maniatis et al. (1982). A bovine brain eDNA library constructed in )~gtl0 was kindly donated by A. E Jackson and E Parham (Department of Structural Biology, Stanford University School of Medicine, Stanford, CA) (Jackson et al., 1987). Oligonucleotides were end labeled with 32p and used to screen 5 x 10 s plaques, washing the filters in 2x SSC at 42°C. Positive clones were plaque purified, digested with Eco RI to determine the size of the inserts, and Southern blotted onto nitrocellulose. Radioactive probes were made from the different inserts either by nick translation or by subcloning into M13 mpl9 and synthesizing a radiolabeled second strand which could then be cut with a suitable enzyme and gel purified. A hgtll mouse brain eDNA library, kindly provided by Y. Citri (Weizmann Institute of Science, Rehovot, Israel) (Martinez et al., 1987), was screened with the radiolabeled bovine brain inserts. Selected mouse brain inserts obtained from this screen were subcloned into a Bluescript plasmid vector (Stratagene Cloning Systems, San Diego, CA) for restriction mapping. Sequencing was carried out on consecutive and overlapping restriction fragments subcloned into M13 mpl8 or mpl9, using the dideoxy chain termination method (Sanger et al., 1977). To sequence the entire coding region of both cDNAs in both directions, synthetic oligonucleotides were used as primers to fill in the gaps. Northern and Southern Blots For Northern blotting, poly A-containing RNA was purified from mouse brain and mouse liver by the lithium/urea method (Auffray and Rougeon, 1980), subjected to electrophoresis (15 #g/lane), and blotted onto Hybond paper. The blots were probed with M13 fragments and washed at 65°C in 0.1x SSC. POly A-minus RNA from each of the two tissues was used as a control. Labeling of the tissues was quantified by cutting out the lane of interest and measuring the radioactivity, and then subtracting the radioactivity present in a control lane as background. The mean ratios from three separate experiments were taken. Southern blots were performed on genomic DNA purified from mouse liver, using nick-translated restriction fragments as probes. Low stringency labeling was carded out by incubating with the probe in 35% formamide at 42°C and washing in 2x SSC at 65°C, while the high stringency incubation was done in 50% formamide at 42°C, followed by a wash in 0.1x SSC at 65°C. Production of Fusion Protein The hgtll phage containing both sequence 1 and 2 inserts were streaked out onto a lawn of Y1090 host cells. Induction of fusion protein and labeling of the filters were carried out as described by Huynh et al. (1983). The primary antibodies used for screening were a mixture of the monoclonal antibody AC1-Mll (Robinson, 1987) and an affinity-purified rabbit polyclonal antiserum against total HA-II 100-kD proteins, prepared essentially as described (Robinson and Pearse, 1986). Phage that produced a signal were then used as lysogens to infect Y1089 cells (Huynh et al., 1983). Crude cell lysates were subjected to electrophoresis and blotted, and the blots were labeled with ACI-MI1 (Robinson, 1987). In Situ Hybridization Freshly dissected adult mouse brains were frozen in dry ice, and 12-#m sections were cut using a cryostat. The sections were treated essentially as described by Goedert (1987), except that they were l~0cked with acetic anhydride after the pronase digestion step, and extracted with chloroform after serial dehydration in ethanol. Hybridization was carried out using single stranded 3:p-labeled M13 probes in a hybridization mix containing 50% formamide for 16-20 h at 42°C, and the slides were washed in 0.1× SSC at 60°C. The probes were prepared by subcloning Hind III/Eco R1 fragments (bases 2,719-3,298 for gene 1 and bases 2,449-3,096 for gene 2) into both mpl8 and mpl9 and synthesizing a labeled second strand which was then cut with Eco R1 (mpl8) or Hind III (mpl9). The mpl9 probes were thus in the antisense direction, while the mpl8 probes were in the sense direction and were used as controls. The slides were exposed on Fuji x-ray film for 3 d to make contact prints, and were then dipped in emulsion and exposed for 2-4 wk before being developed.